grna target sequences Search Results


90
Bioscientifica Ltd guide rna (grna) dna target sequence
Guide Rna (Grna) Dna Target Sequence, supplied by Bioscientifica Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) dna target sequence/product/Bioscientifica Ltd
Average 90 stars, based on 1 article reviews
guide rna (grna) dna target sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′)
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Snx2 Crispr Grna Plasmid (Grna Targeting Sequence: 5′ Tgatggcatgaatgcctata 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Synthego Inc grna targeting sequence cctgtcctcaggacaaacgc
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Grna Targeting Sequence Cctgtcctcaggacaaacgc, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna targeting sequence cctgtcctcaggacaaacgc/product/Synthego Inc
Average 90 stars, based on 1 article reviews
grna targeting sequence cctgtcctcaggacaaacgc - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation grna sequences targeting cyclin t1
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Grna Sequences Targeting Cyclin T1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequences targeting cyclin t1/product/GenScript corporation
Average 90 stars, based on 1 article reviews
grna sequences targeting cyclin t1 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation reference mouse glut1 cdna
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Reference Mouse Glut1 Cdna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reference mouse glut1 cdna/product/GenScript corporation
Average 90 stars, based on 1 article reviews
reference mouse glut1 cdna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
CustomArray Inc oligonucleotide pool encoding grna and target sequence
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Oligonucleotide Pool Encoding Grna And Target Sequence, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotide pool encoding grna and target sequence/product/CustomArray Inc
Average 90 stars, based on 1 article reviews
oligonucleotide pool encoding grna and target sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Benchling Inc off-target list for gnao1 g203 grna sequence
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Off Target List For Gnao1 G203 Grna Sequence, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/off-target list for gnao1 g203 grna sequence/product/Benchling Inc
Average 90 stars, based on 1 article reviews
off-target list for gnao1 g203 grna sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Genechem shrna-ccat1-1/2
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Shrna Ccat1 1/2, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna-ccat1-1/2/product/Genechem
Average 90 stars, based on 1 article reviews
shrna-ccat1-1/2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Benchling Inc 20 bp grna sequence targeting at the kanmx gene (gccgcgattaaattccaaca)
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
20 Bp Grna Sequence Targeting At The Kanmx Gene (Gccgcgattaaattccaaca), supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/20 bp grna sequence targeting at the kanmx gene (gccgcgattaaattccaaca)/product/Benchling Inc
Average 90 stars, based on 1 article reviews
20 bp grna sequence targeting at the kanmx gene (gccgcgattaaattccaaca) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Verlag GmbH grna-target sequence pairs
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Grna Target Sequence Pairs, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna-target sequence pairs/product/Verlag GmbH
Average 90 stars, based on 1 article reviews
grna-target sequence pairs - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc5
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
P58 Backbone With 2 Grna Targeting Sequence For Pdc5, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p58 backbone with 2 grna targeting sequence for pdc5/product/KU Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc5 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) sequences targeting the exon regions of the human il15ra gene/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: SDS Page, Transfection, Construct, Two Tailed Test

High throughput measurement of repair outcomes. Constructs containing both a gRNA and its target sequence (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: High throughput measurement of repair outcomes. Constructs containing both a gRNA and its target sequence (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: High Throughput Screening Assay, Construct, Sequencing, Clone Assay, Amplification

A.Example measured repair profile reproducibility of one gRNA-target pair. DNA sequence of the target (top) is edited to produce a range of outcomes in two synthetic replicates (green, blue bars) and one endogenous measurement (orange bars). The proportions (x-axis) of the four most frequent mutational outcomes (e.g. “D3” - deletion of three base pairs, “I1” - insertion of one base pair, etc.; y-axis) is consistent between the experiments. Stretches of microhomology (green) and inserted sequences (red) are highlighted at the cut site (dashed vertical line). B.Synthetic measurements faithfully capture endogenous outcomes. Symmetrized Kullback-Leibler divergence (white to black color scale) between the measured repair profiles (e.g. ) in our synthetic measurements in K562 cells (x-axis) when compared to the same individual gRNAs in endogenous measurements from van Overbeek et al. (y-axis). C.Synthetic measurements are reproducible and gRNA-specific. Box plots (orange median line, quartiles for box edges, 95% whiskers) of symmetrised KL divergences between replicate measurements of over 6000 gRNAs (left), as well as two different sets of randomly selected gRNA pairs (middle, right) using the same library of constructs (green boxes) and a separately cloned library of corresponding constructs (blue boxes). D.Frame information is reproducible between replicates, and well correlated with endogenous outcomes. In-frame percentages for one biological replicate of our synthetic measurements (y-axis) contrasted against another replicate (x-axis, blue markers, Pearson’s R=0.895), or endogenous measurements (x-axis, orange markers, Pearson’s R=0.78). E.Low coverage and large deletions are the main sources of discrepancy between endogenous and synthetic measurements. Symmetrized KL divergence (y-axis) between endogenous and synthetic measurements of the same gRNA editing outcomes (individual markers) is dependent on the sequencing coverage (log 10 (number of obtained reads), x-axis), and frequency of very large deletions (colors). Three target sequences that frequently give rise to very large deletions (red, purple) are not well captured by our assay by design.

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Example measured repair profile reproducibility of one gRNA-target pair. DNA sequence of the target (top) is edited to produce a range of outcomes in two synthetic replicates (green, blue bars) and one endogenous measurement (orange bars). The proportions (x-axis) of the four most frequent mutational outcomes (e.g. “D3” - deletion of three base pairs, “I1” - insertion of one base pair, etc.; y-axis) is consistent between the experiments. Stretches of microhomology (green) and inserted sequences (red) are highlighted at the cut site (dashed vertical line). B.Synthetic measurements faithfully capture endogenous outcomes. Symmetrized Kullback-Leibler divergence (white to black color scale) between the measured repair profiles (e.g. ) in our synthetic measurements in K562 cells (x-axis) when compared to the same individual gRNAs in endogenous measurements from van Overbeek et al. (y-axis). C.Synthetic measurements are reproducible and gRNA-specific. Box plots (orange median line, quartiles for box edges, 95% whiskers) of symmetrised KL divergences between replicate measurements of over 6000 gRNAs (left), as well as two different sets of randomly selected gRNA pairs (middle, right) using the same library of constructs (green boxes) and a separately cloned library of corresponding constructs (blue boxes). D.Frame information is reproducible between replicates, and well correlated with endogenous outcomes. In-frame percentages for one biological replicate of our synthetic measurements (y-axis) contrasted against another replicate (x-axis, blue markers, Pearson’s R=0.895), or endogenous measurements (x-axis, orange markers, Pearson’s R=0.78). E.Low coverage and large deletions are the main sources of discrepancy between endogenous and synthetic measurements. Symmetrized KL divergence (y-axis) between endogenous and synthetic measurements of the same gRNA editing outcomes (individual markers) is dependent on the sequencing coverage (log 10 (number of obtained reads), x-axis), and frequency of very large deletions (colors). Three target sequences that frequently give rise to very large deletions (red, purple) are not well captured by our assay by design.

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing, Construct, Clone Assay

A.Single base insertions are most common, with a long tail of moderately long deletions. The frequency (y-axis) of deletion or insertion size (x-axis), averaged across genomic sequence targets. B.Editing outcome types are diverse. The average percent occurrence (area of wedge) of small (<4nt) and large (≥4nt) deletions, both microhomology-mediated and not, as well as small (1nt) and large (>1nt) insertions, measured in K562 cells, and averaged across genomic sequence targets. C.Per-gRNA event frequencies differ across indel classes. Number of individual indels (y-axis) as a percentage of all mutations observed for their gRNA (x-axis) separated by mutations class (rows). Colors as in (B). D.Specific single insertions and microhomology-mediated deletions are the most frequent reproducible mutation classes. The percent of gRNAs (area of wedge) that have the same specific indel as their most frequent mutation in all three replicates, stratified by indel class (colors). ‘No consensus’: inconsistent most frequent mutation across replicates. E.A single allele often accounts for a large fraction of editing outcomes for a gRNA. Number of gRNAs (y-axis) with the frequency of its most common outcome (x-axis) in K562 cells. F.A small number of outcomes explains most of the observed data, but many low frequency alleles are present. Cumulative fraction of observed data (y-axis) matching an increasing number of outcomes (x-axis) for each target in K562 cells (grey lines), and their average (blue line).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Single base insertions are most common, with a long tail of moderately long deletions. The frequency (y-axis) of deletion or insertion size (x-axis), averaged across genomic sequence targets. B.Editing outcome types are diverse. The average percent occurrence (area of wedge) of small (<4nt) and large (≥4nt) deletions, both microhomology-mediated and not, as well as small (1nt) and large (>1nt) insertions, measured in K562 cells, and averaged across genomic sequence targets. C.Per-gRNA event frequencies differ across indel classes. Number of individual indels (y-axis) as a percentage of all mutations observed for their gRNA (x-axis) separated by mutations class (rows). Colors as in (B). D.Specific single insertions and microhomology-mediated deletions are the most frequent reproducible mutation classes. The percent of gRNAs (area of wedge) that have the same specific indel as their most frequent mutation in all three replicates, stratified by indel class (colors). ‘No consensus’: inconsistent most frequent mutation across replicates. E.A single allele often accounts for a large fraction of editing outcomes for a gRNA. Number of gRNAs (y-axis) with the frequency of its most common outcome (x-axis) in K562 cells. F.A small number of outcomes explains most of the observed data, but many low frequency alleles are present. Cumulative fraction of observed data (y-axis) matching an increasing number of outcomes (x-axis) for each target in K562 cells (grey lines), and their average (blue line).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing, Mutagenesis

A.Nearby matching sequences are used as substrate for microhomology-mediated repair more frequently than distant ones. Fraction of mutated reads (y-axis) for increasing distance between matching sequences of length 9 (x-axis) for individual targets (blue markers) in K562 cells, and a linear regression fit to the trend (solid line). B.Frequency of microhomology-mediated repair depends on the length of and distance between the matching sequences. Same as (A), but linear regression fits only for microhomologies of lengths 3 (gray, bottom) to 15 (yellow, top), with Pearson’s correlation noted in the legend. C.GC content influences microhomology-mediated repair fidelity. Percent gRNA reads with length 9 microhomology-mediated deletion (y-axis; boxes median and quartiles, whiskers 5% and 95%) across a range of GC contents (x-axis). D.Mutations in microhomology sequence reduce repair outcome frequency, but corresponding deletions are still present. For matched pairs of gRNAs, with and without mutations in the microhomologous sequence, the fraction of mutated reads associated with the particular microhomology with mismatches (y-axis) vs without mismatches (x-axis) (markers; blue: one mismatch, yellow: two mismatches; solid lines: linear regression fits). Dashed black line: y=x. E.The sequence context at the cut site influences which single base is inserted. PAM-distal (blue), PAM-proximal (green), and other (red) nucleotide insertion frequency of all single base insertions; if proximal and distal bases are identical (orange), no call can be made. F.Single base insertion rate depends on the PAM-distal base adjacent to the cut site. The average percent of per-gRNA mutations that are unambiguous PAM-distal 1bp insertions (y-axis), stratified by the PAM-distal nucleotide (x-axis).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Nearby matching sequences are used as substrate for microhomology-mediated repair more frequently than distant ones. Fraction of mutated reads (y-axis) for increasing distance between matching sequences of length 9 (x-axis) for individual targets (blue markers) in K562 cells, and a linear regression fit to the trend (solid line). B.Frequency of microhomology-mediated repair depends on the length of and distance between the matching sequences. Same as (A), but linear regression fits only for microhomologies of lengths 3 (gray, bottom) to 15 (yellow, top), with Pearson’s correlation noted in the legend. C.GC content influences microhomology-mediated repair fidelity. Percent gRNA reads with length 9 microhomology-mediated deletion (y-axis; boxes median and quartiles, whiskers 5% and 95%) across a range of GC contents (x-axis). D.Mutations in microhomology sequence reduce repair outcome frequency, but corresponding deletions are still present. For matched pairs of gRNAs, with and without mutations in the microhomologous sequence, the fraction of mutated reads associated with the particular microhomology with mismatches (y-axis) vs without mismatches (x-axis) (markers; blue: one mismatch, yellow: two mismatches; solid lines: linear regression fits). Dashed black line: y=x. E.The sequence context at the cut site influences which single base is inserted. PAM-distal (blue), PAM-proximal (green), and other (red) nucleotide insertion frequency of all single base insertions; if proximal and distal bases are identical (orange), no call can be made. F.Single base insertion rate depends on the PAM-distal base adjacent to the cut site. The average percent of per-gRNA mutations that are unambiguous PAM-distal 1bp insertions (y-axis), stratified by the PAM-distal nucleotide (x-axis).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing